- Kilo-scale synthesis process for 2′-O-(2-methoxyethyl)-pyrimidine derivatives
-
We describe an improved process to produce 2′-O-(2-methoxyethyl)- pyrimidines. Starting with commercially available O-2,2′-anhydro-5- methyluridine and tris-(2-methoxyethyl)borate, we modified the ring-opening reaction conditions and changed to a continuous extraction purification method to give 2′-O-(2-methoxyethyl)-5-methyluridine. The dimethoxytritylation 5′/3′ ratios and yield were improved by the use of 2,6-lutidine as the base. Conditions to convert to the 5-methylcytidine analog and its isolation by crystallization were optimized. Final benzoylation was improved by developing a method to selectively hydrolyze benzoyl ester impurities. Copyright Taylor & Francis, Inc.
- Ross, Bruce S.,Song, Quanlai,Han, Mingming
-
-
Read Online
- METHODS FOR THE PREVENTION AND TREATMENT OF MAJOR ADVERSE CARDIOVASCULAR EVENTS USING COMPOUNDS THAT MODULATE APOLIPOPROTEIN B
-
Provided herein, for example, are methods generally relating to preventing, treating and/or managing a major adverse cardiovascular event in a subject with a disease or condition at risk for a major adverse cardiovascular event, e.g., familial hypercholesterolemia. Also provided herein are methods relating to administering to the patient a therapeutically effective amount of an antisense oligonucleotide having a nucleobase SEQ ID NO: 247 (e.g., mipomersen).
- -
-
-
- EFFECTS OF APOLIPOPROTEIN B INHIBITION ON GENE EXPRESSION PROFILES IN ANIMALS
-
Antisense compounds, compositions and methods are provided for modulating the expression of apolipoprotein B. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding apolipoprotein B. Methods of using these compounds for modulation of apolipoprotein B expression and for treatment of diseases associated with expression of apolipoprotein B are provided. Methods are provided for modulating the expression of genes involved in lipid metabolism, useful in the treatment of conditions associated with cardiovascular risk. Antisense oligonucleotides targeted to apolipoprotein B reduce the level of apolipoprotein B mRNA, lower serum cholesterol and shift liver gene expression profiles from those of an obese animal towards those of a lean animal. Further provided are methods for improving the cardiovascular risk of a subject through antisense inhibition of apolipoprotein B. Also provided are methods for employing antisense oligonucleotides targeted to apolipoprotein B to modulate a cellular pathway or metabolic process.
- -
-
-
- Scalable synthesis of substituted 2,7-dimethyl-9-phenylxanthen-9-ol (DMPx-OH): Useful for the preparation of crystalline 5′-O-DMPx-protected nucleosides
-
A convenient single-step synthesis of several 2,7-dimethyl-9-phenylxanthen- 9-ol (DMPx-OH) analogs has been accomplished using a Friedel-Crafts reaction. Treatment of various DMPx-OH with unprotected 2′-O-methoxyethyl- ribonucleosides (MOE) in the presence of B(C6F5) 3, as a Lewis Acid catalyst, furnished 5′-O-protected derivatives of 2′-MOE-ribonucleosides in good yields. The deprotection of the DMPx groups was accomplished by acid hydrolysis under very mild conditions. Among the five DMPx analogs synthesized, the 2,7-dimethyl-9-(4-nitrophenyl) xanthene-9-yl group furnished crystalline products enabling non-chromatographic isolation of 5′-O-protetced nucleosides.
- Banerjee, Shyamapada,Srishylam,Rajendra Prasad,Migawa, Michael T.,Swayze, Eric E.,Sanghvi, Yogesh S.
-
body text
p. 4669 - 4672
(2012/09/07)
-
- Antisense modulation of CD40 ligand expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of CD40 ligand. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding CD40 ligand. Methods of using these compounds for modulation of CD40 ligand expression and for treatment of diseases associated with expression of CD40 ligand are provided.
- -
-
Page/Page column 18
(2008/06/13)
-
- Antisense modulation of PTP1B expression
-
Compositions and methods are provided for decreasing blood glucose levels in an animal or for preventing or delaying the onset of a rise in blood glucose levels in an animal, comprising administering to said animal an antisense inhibitor of PTP1B expression in combination with at least one glucose-lowering drug. The present invention is also directed to compositions and methods for improving insulin sensitivity in an animal or for preventing or delaying the onset of insulin resistance in an animal. Also provided are compositions and methods for treating or preventing a metabolic condition in an animal. The metabolic condition may be, e.g., diabetes or obesity.
- -
-
Page/Page column 14-15
(2008/06/13)
-
- ANTISENSE MODULATION OF LFA-3
-
Compositions and methods for the treatment and diagnosis of diseases or disorders amenable to treatment through modulation of expression of a nucleic acid encoding a lymphocyte function associated antigen 3 (LFA-3; also known as CD58) protein are provided.
- -
-
-
- Antisense oligonucleotide modulation of STAT3 expression
-
Compounds, compositions and methods are provided for inhibiting the expression of human STAT3. The compositions comprise antisense oligonucleotides targeted to nucleic acids encoding STAT3. Methods of using these oligonucleotides for inhibition of STAT3 expression and for promotion of apoptosis are provided. Methods for treatment of diseases, particularly inflammatory diseases and cancers, associated with overexpression or constitutive activation of STAT3 or insufficient apoptosis are also provided.
- -
-
-
- Antisense oligonucleotide modulation of tumor necrosis factor-alpha (TNF-alpha) expression
-
Compositions and methods are provided for inhibiting the expression of human tumor necrosis factor-α (TNF-α). Antisense oligonucleotides targeted to nucleic acids encoding TNF-α are preferred. Methods of using these oligonucleotides for inhibition of TNF-α expression and for treatment of diseases, particularly inflammatory and autoimmune diseases, associated with overexpression of TNF-α are provided.
- -
-
-
- Antisense modulation of superoxide dismutase 1, soluble expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of superoxide dismutase 1, soluble. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding superoxide dismutase 1, soluble. Methods of using these compounds for modulation of superoxide dismutase 1, soluble expression and for treatment of diseases associated with expression of superoxide dismutase 1, soluble are provided.
- -
-
-
- Antisense modulation of stearoyl-CoA desaturase expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of stearoyl-CoA desaturase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding stearoyl-CoA desaturase. Methods of using these compounds for modulation of stearoyl-CoA desaturase expression and for treatment of diseases associated with expression of stearoyl-CoA desaturase are provided.
- -
-
-
- Antisense modulation of connective tissue growth factor expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of connective tissue growth factor. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding connective tissue growth factor. Methods of using these compounds for modulation of connective tissue growth factor expression and for treatment of diseases associated with expression of connective tissue growth factor are provided.
- -
-
-
- Antisense modulation of wrn espression
-
Antisense compounds, compositions and methods are provided for modulating the expression of WRN. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding WRN. Methods of using these compounds for modulation of WRN expression and for treatment of diseases associated with expression of WRN are provided.
- -
-
-
- Antisense modulation of interferon gamma receptor 2
-
Antisense compounds, compositions and methods are provided for modulating the expression of Interferon gamma receptor 2. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding Interferon gamma receptor 2. Methods of using these compounds for modulation of Interferon gamma receptor 2 expression and for treatment of diseases associated with expression of Interferon gamma receptor 2 are provided.
- -
-
-
- Antisense modulation of EIF2C1 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of EIF2C1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding EIF2C1. Methods of using these compounds for modulation of EIF2C1 expression and for treatment of diseases associated with expression of EIF2C1 are provided.
- -
-
-
- Antisense modulation of dual specific phosphatase 5 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of dual specific phosphatase 5. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding dual specific phosphatase 5. Methods of using these compounds for modulation of dual specific phosphatase 5 expression and for treatment of diseases associated with expression of dual specific phosphatase 5 are provided.
- -
-
-
- Antisense modulation of thyroid hormone receptor interactor 6 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of thyroid hormone receptor interactor 6. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding thyroid hormone receptor interactor 6. Methods of using these compounds for modulation of thyroid hormone receptor interactor 6 expression and for treatment of diseases associated with expression of thyroid hormone receptor interactor 6 are provided.
- -
-
-
- Antisense modulation of p70 S6 kinase expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of p70 S6 kinase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding p70 S6 kinase. Methods of using these compounds for modulation of p70 S6 kinase expression and for treatment of diseases associated with expression of p70 S6 kinase are provided.
- -
-
-
- Compositions and methods for the delivery of oligonucleotides via the alimentary canal
-
The present invention relates to compositions and methods which enhance the transport of nucleic acids, especially oligonucleotides at various sites in the alimentary canal of an animal. The methods and compositions enhance the transport of oligonucleotides across the mucosa of the alimentary canal via the use of one or more penetration enhancers. The invention features the use of various fatty acids, bile salts, chelating agents and other penetration enhancers, as well as carrier compounds, to enhance the stability of nucleic acids and/or their transport across and/or into cells of the alimentary canal. In one preferred embodiment, the compositions and methods of the invention are utilized to effect the oral delivery of an antisense oligonucleotide to an animal in order to modulate the expression of a gene in the animal for investigative, therapeutic or prophylactic purposes.
- -
-
-
- Antisense modulation of survivin expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of Survivin. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding Survivin. Methods of using these compounds for modulation of Survivin expression and for treatment of diseases associated with expression of Survivin are provided.
- -
-
-
- SUBSTITUTED PIXYL PROTECTING GROUPS FOR OLIGONUCLEOTIDE SYNTHESIS
-
The present invention describes an improved hydroxyl protecting group of formula (1), wherein R2 and R7 are specified substituents and Q is O, S, NR10 or N(C=O)R10.
- -
-
Page/Page column 6
(2008/06/13)
-
- Modulation of CEACAM1 expression
-
Compounds, compositions and methods are provided for modulating the expression of CEACAM1. The compositions comprise oligonucleotides, targeted to nucleic acid encoding CEACAM1. Methods of using these compounds for modulation of CEACAM1 expression and for diagnosis and treatment of disease associated with expression of CEACAM1 are provided.
- -
-
Page/Page column 26
(2010/02/11)
-
- Antisense modulation of polo-like kinase expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of polo-like kinase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding polo-like kinase. Methods of using these compounds for modulation of polo-like kinase expression and for treatment of diseases associated with expression of polo-like kinase are provided.
- -
-
Page/Page column 18-19
(2008/06/13)
-
- ANTISENSE MODULATION OF STEAROYL-COA DESATURASE EXPRESSION
-
Antisense compounds, compositions and methods are provided for modulating the expression of stearoyl-CoA desaturase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding stearoyl-CoA desaturase. Methods of using these compounds for modulation of stearoyl-CoA desaturase expression and for treatment of diseases associated with expression of stearoyl-CoA desaturase are provided.
- -
-
Page/Page column 91
(2010/02/10)
-
- Modulation of DC-SIGN expression
-
Compounds, compositions and methods are provided for modulating the expression of DC-SIGN. The compositions comprise oligonucleotides, targeted to nucleic acid encoding DC-SIGN. Methods of using these compounds for modulation of DC-SIGN expression and for diagnosis and treatment of diseases and conditions associated with expression of DC-SIGN are provided.
- -
-
Page/Page column 12
(2008/06/13)
-
- TRPM-2 antisense therapy using an oligonucleotide having 2′-O-(2-methoxy)ethyl modifications
-
A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2′-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2′-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.
- -
-
-
- Antisense inhibition via RNAse H-independent reduction in mRNA
-
The present invention provides compositions and methods for reducing levels of a preselected mRNA, using antisense compounds targeted to a splice site or a region up to 50 nucleobases upstream of an exon/intron junction on said mRNA. Preferably, said antisense compounds do not elicit RNAse H cleavage of the mRNA.
- -
-
Page/Page column 18
(2010/02/12)
-
- Antisense modulation of phospholipase D2 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of phospholipase D2. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding phospholipase D2. Methods of using these compounds for modulation of phospholipase D2 expression and for treatment of diseases associated with expression of phospholipase D2 are provided.
- -
-
Page/Page column 19
(2008/06/13)
-
- Antisense modulation of DEXRAS1 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of DEXRAS1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding DEXRAS1. Methods of using these compounds for modulation of DEXRAS1 expression and for treatment of diseases associated with expression of DEXRAS1 are provided.
- -
-
Page/Page column 18
(2008/06/13)
-
- Oligonucleotide compositions and methods for the modulation of the expression of B7 protein
-
Compositions and methods for the treatment of asthma with oligonucleotides which specifically hybridize with nucleic acids encoding B7 proteins.
- -
-
-
- Modulation of PTEN expression via oligomeric compounds
-
Oligomeric compounds, compositions and methods are provided for modulating the expression of PTEN. The compositions comprise oligomeric compounds, particularly double stranded oligomeric compounds, targeted to nucleic acids encoding PTEN. Methods of using these compounds for modulation of PTEN expression and for treatment of diseases and conditions associated with expression of PTEN are provided. Such conditions include diabetes and hyperproliferative conditions. Methods for decreasing blood glucose levels, inhibiting PEPCK expression, decreasing blood insulin levels, decreasing insulin resistance, increasing insulin sensitivity, decreasing blood triglyceride levels or decreasing blood cholesterol levels in an animal, among others, using the compounds of the invention are also provided. The animal is preferably a human; also preferably the animal is a diabetic animal.
- -
-
-
- Antisense oligonucleotide modulation of human serine/threonine protein phosphatase gene expression
-
Oligonucleotides are provided which are targeted to nucleic acids encoding human serine/threonine protein phosphatases and which are capable of inhibiting protein phosphatase expression. Methods of inhibiting the expression of human protein serine/threonine phosphatases using oligonucleotides of the invention are also provided. The present invention further comprises methods of preventing or inhibiting hyperproliferation of cells and methods of treating abnormal conditions, including cancer, using oligonucleotides of the invention.
- -
-
-
- Antisense modulation of mitoNEET expression
-
Antisense compounds, compositions, and methods are provided for modulating the expression of a family of polypeptides from mitochondrial membranes, which bind insulin sensitizing, antidiabetic thiazolodinediones (mitoNEET). The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding mitoNEET. Methods of using these compounds for modulation of mitoNEET expression and for treatment of diseases associated with expression of mitoNEET are provided.
- -
-
-
- Compositions and mehtods for treatment of Hepatitis C virus-associated diseases
-
Antisense oligonucleotides are provided which are complementary to and hybridizable with at least a portion of HCV RNA and which are capable of inhibiting the function of the HCV RNA. These oligonucleotides can be administered to inhibit the activity of Hepatitis C virus in vivo or in vitro. These compounds can be used either prophylactically or therapeutically to reduce the severity of diseases associated with Hepatitis C virus, and for diagnosis and detection of HCV and HCV-associated diseases. Methods of using these compounds are also disclosed.
- -
-
-
- Oligonucleotide compositions and methods for the modulation of the expression of B7 protein
-
Compositions and methods for the treatment of asthma with oligonucleotides which specifically hybridize with nucleic acids encoding B7 proteins.
- -
-
-
- Antisense oligonucleotide modulation of tumor necrosis factor-alpha (TNF-alpha) expression
-
Compositions and methods are provided for inhibiting the expression of human tumor necrosis factor-α (TNF-α). Antisense oligonucleotides targeted to nucleic acids encoding TNF-α are preferred. Methods of using these oligonucleotides for inhibition of TNF-α expression and for treatment of diseases, particularly inflammatory and autoimmune diseases, associated with overexpression of TNF-α are provided.
- -
-
-
- Antisense modulation of p38 mitogen activated protein kinase expression
-
Compositions and methods for the treatment and diagnosis of diseases or conditions amenable to treatment through modulation of expression of a gene encoding a p38 mitogen-activated protein kinase (p38 MAPK) are provided. Methods for the treatment and diagnosis of diseases or conditions associated with aberrant expression of one or more p38 MAPKs are also provided.
- -
-
-
- Use of integrin-linked kinase inhibitors for treating insulin resistance, hyperglycemia and diabetes
-
The present invention features methods for treating conditions of insulin resistance, hyperglycemia and/or diabetes. In a broad embodiment, the methods comprise the step of administering to a mammal in need of treatment a therapeutically effective amount of an ILK inhibitor. ILK inhibitors in accordance with the present invention includes small molecules, antibodies, peptides, and antisense compounds. In one embodiment, antisense compounds in accordance with the present invention comprise antisense oligomers.
- -
-
-
- Antisense modulation of cellular inhibitor of apoptosis-1 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of Cellular Inhibitor of Apoptosis-1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding Cellular Inhibitor of Apoptosis-1. Methods of using these compounds for induction of cellular apoptosis are provided.
- -
-
-
- Antisense modulation of clusterin expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of clusterin. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding clusterin. Methods of using these compounds for modulation of clusterin expression and for treatment of diseases associated with expression of clusterin are provided.
- -
-
-
- Antisense modulation of TNFR1 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of TNFR1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding TNFR1. Methods of using these compounds for modulation of TNFR1 expression and for treatment of diseases associated with expression of TNFR1 are provided.
- -
-
-
- Antisense modulation of src-c expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of src-c. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding src-c. Methods of using these compounds for modulation of src-c expression and for treatment of diseases associated with expression of src-c are provided.
- -
-
-
- Antisense modulation of sap-1 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of SAP-1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding SAP-1. Methods of using these compounds for modulation of SAP-1 expression and for treatment of diseases associated with expression of SAP-1 are provided.
- -
-
-
- Antisense modulation of c-reactive protein expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of C-reactive protein. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding C-reactive protein. Methods of using these compounds for modulation of C-reactive protein expression and for treatment of diseases associated with expression of C-reactive protein are provided.
- -
-
-
- Antisense modulation of interleukin 12 p35 subunit expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of Interleukin 12 p35 subunit. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding Interleukin 12 p35 subunit. Methods of using these compounds for modulation of Interleukin 12 p35 subunit expression and for treatment of diseases associated with expression of Interleukin 12 p35 subunit are provided.
- -
-
-
- Antisense modulation of stearoyl-coa desaturase expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of stearoyl-CoA desaturase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding stearoyl-CoA desaturase. Methods of using these compounds for modulation of stearoyl-CoA desaturase expression and for treatment of diseases associated with expression of stearoyl-CoA desaturase are provided.
- -
-
-
- Antisense modulation of acyl coa cholesterol acyltransferase-2 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of acyl CoA cholesterol acyltransferase-2. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding acyl CoA cholesterol acyltransferase-2. Methods of using these compounds for modulation of acyl CoA cholesterol acyltransferase-2 expression and for treatment of diseases associated with expression of acyl CoA cholesterol acyltransferase-2 are provided.
- -
-
-
- Antisense modulation of PTPRM expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of PTPRM. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding PTPRM. Methods of using these compounds for modulation of PTPRM expression and for treatment of diseases associated with expression of PTPRM are provided.
- -
-
Page/Page column 18
(2008/06/13)
-
- Antisense modulation of CD36 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of CD36. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding CD36. Methods of using these compounds for modulation of CD36 expression and for treatment of diseases associated with expression of CD36 are provided.
- -
-
Page/Page column 16
(2010/02/06)
-
- Antisense modulation of resistin expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of resistin. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding resistin. Methods of using these compounds for modulation of resistin expression and for treatment of diseases associated with expression of resistin are provided.
- -
-
Page/Page column 18-19
(2010/02/05)
-