Two family 11 xylanases from Achaetomium sp. Xz-8 with high catalytic efficiency and application potentials in the brewing industry

Article abstract of DOI:10.1021/jf4001296

This study identified two family-11 xylanase genes (xynC81 and xynC83) in Achaetomium sp. Xz-8, a thermophilic strain from a desert area with substantial xylanase activity, and successfully expressed them in Pichia pastoris. Their deduced amino acid sequences showed the highest identity of ≤90% to known fungal xylanases and of ≤62% with each other. The purified recombinant xylanases showed optimal activities at pH 5.5 and 60-65 C and exhibited stability over pH 5.0-10.0 and temperatures at 55 C and below. XynC81 had high catalytic efficiency (6082 mL/s/mg), and XynC83 was favorable for xylooligosaccharide production. Under simulated mashing conditions, combination of XynC83 and a commercial β-glucanase improved the filtration rate by 34.76%, which is much better than that of Novozymes Ultraflo (20.71%). XynC81 and XynC83 had a synergistic effect on viscosity reduction (7.08%), which is comparable with that of Ultraflo (8.47%). Thus, XynC81 and XynC83 represent good candidates for application in the brewing industry.

Full text of DOI:10.1021/jf4001296

Article
pubs.acs.org/JAFC
Two Family 11 Xylanases from Achaetomium sp. Xz‑8 with High
Catalytic Efficiency and Application Potentials in the Brewing
Industry
Liang Zhao,†,‡,∥ Kun Meng,†,∥ Yingguo Bai,† Pengjun Shi,† Huoqing Huang,† Huiying Luo,† Yaru Wang,†
Peilong Yang,† Wei Song,‡ and Bin Yao*,†
†Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural
Sciences, Beijing 100081, People’s Republic of China
‡College of Life Science, Capital Normal University, Beijing 100048, People’s Republic of China
ABSTRACT: This study identified two family-11 xylanase genes (xynC81 and xynC83) in Achaetomium sp. Xz-8, a thermophilic
strain from a desert area with substantial xylanase activity, and successfully expressed them in Pichia pastoris. Their deduced
amino acid sequences showed the highest identity of ≤90% to known fungal xylanases and of ≤62% with each other. The purified
recombinant xylanases showed optimal activities at pH 5.5 and 60−65 °C and exhibited stability over pH 5.0−10.0 and
temperatures at 55 °C and below. XynC81 had high catalytic efficiency (6082 mL/s/mg), and XynC83 was favorable for
xylooligosaccharide production. Under simulated mashing conditions, combination of XynC83 and a commercial β-glucanase
improved the filtration rate by 34.76%, which is much better than that of Novozymes Ultraflo (20.71%). XynC81 and XynC83
had a synergistic effect on viscosity reduction (7.08%), which is comparable with that of Ultraflo (8.47%). Thus, XynC81 and
XynC83 represent good candidates for application in the brewing industry.
KEYWORDS: Achaetomium, xylanase, heterologous expression, catalytic efficiency, brewing
now, only one thermophilic species, Achaetomium thermophi-
lum, has been reported.9
INTRODUCTION
■
Endo-1,4-β-xylanase (EC 3.2.1.8) is the crucial enzyme that
randomly cleaves the β-1,4-glycosidic linkages of the xylan
backbone, releasing xylooligomers of different lengths. Accord-
ing to the amino acid sequence-based classification of glycoside
hydrolases (GH) (http://www.cazy.org/fam/acc_GH.html),1
enzymes with xylanase activity belong to families 5, 7, 8, 10, 11,
and 43. Compared to other counterparts, xylanases of family 11
have several interesting properties, such as high substrate
selectivity and catalytic efficiency, relatively small size (around
20 kDa), and variety of pH and temperature optima, making
them attractive and suitable for various applications.2
Xylan is a major structural polysaccharide of plant cell walls
and accounts for approximately 33% of all renewable organic
carbon on earth.3 For efficient conversion of xylan into
economically valuable products, such as xylooligosaccharide,
xylulose, xylitol, and ethanol, more and more research is being
done to explore novel xylanases with specific potentials for
application in animal feed, breadmaking, paper and pulp
industry, waste treatment, brewing, and bioethanol.4,5
A majority of microorganisms, including bacteria, yeasts, and
fungi, produce large amounts of and many different types of
xylanases. Most of these xylanases are thermoliable or of low
efficiency, thus failing to meet the demands of industrializa-
tion.2,6 Thermophilic fungi that produce varieties of high-
temperature-active enzymes are excellent microbial sources of
thermostable/thermotolerant xylanases.7 The genus Achaeto-
mium consists of 25 recorded species to date (http://www.
indexfungorum.org/Names/Names.asp), and most of them are
isolated from soil. This genus was first described by Rai et al. in
1967, and the type species was Achaetomium globosum.8 Until
In this study, we obtained a strain of the genus Achaetomium
from a desert sand sample and cloned two xylanase genes from
it. Their gene products were successfully expressed in Pichia
pastoris, and the recombinant proteins showed superior
properties, such as broad pH and temperature adaptability
and stability, less complex hydrolysis products, and high
catalytic efficiency. Their potential use in the brewing process
was also evaluated.
MATERIALS AND METHODS
■
Microorganism Isolation. The sand sample was collected from a
desert area in Yinchuan, China, with a systematic sampling grid (8 cm
in diameter and 5 cm in depth). One gram of sample was suspended in
9 mL of sterile saline solution (0.75% NaCl) and serially diluted, and
0.1 mL of the dilution was spread onto PDA (BD/Difco, Sparks, MD,
USA) plates. After growth at 45 °C for 3 days, the isolates were
purified and screened on agar plates containing 0.5% (w/v)
beechwood xylan at 45 °C for 5 days. The plates were flooded with
0.1% Congo red and destained with 1 M NaCl as Wood et al.
described.10 Only strains having extracellular xylanase activities showed
clear zones. The strain with the most significant xylanase activity,
designated Xz-8, was identified on the basis of the morphology of
fungal culture as well as the sequences of ITS-5.8S rDNA, β-tubulin
gene, RNA polymerase II second largest subunit gene, and translation
elongation factor 1α gene.11,12
Received: January 14, 2013
Revised: May 20, 2013
Accepted: June 24, 2013
Published: June 24, 2013
© 2013 American Chemical Society
6880
dx.doi.org/10.1021/jf4001296 | J. Agric. Food Chem. 2013, 61, 6880−6889

Journal of Agricultural and Food Chemistry
Article
Table 1. Primers Used in This Study
a
primers
sequences (5′→3′)
size (bp)
XynC81-yzF
XynC81-yzR
ATGGTCACCTTCTCGTCCCTCTTCCTCGCTG
TTAGAGGCACTGCGAGTACCACTGGTTGGCG
31
31
XynC83-yzF
XynC83-yzR
ATGGTCTCCCTCAAGGCCGTTCTTCTCGGCG
31
36
TTACGAGACGGTGATAGACGAAGAACCGCTGCTCTG
XynC81-expF
XynC81-expR
GGGGAATTCGCCCCCGGCGAGCTTCCGGGCA
31
42
GGGGCGGCCGCTTAGAGGCACTGCGAGTACCACTGGTTG
XynC83-expF
XynC83-expR
GGGGAATTCTTCCCGTTCAACGTCACGCAGATGAACG
GGGGCGGCCGCTTACGAGACGGTGATAGACGAAGAACCGC
37
42
a
Restriction sites incorporated into the primers are underlined.
Strains, Plasmids, Culture Media, and Chemicals. Escherichia
Heterologous Expression of xynC81 and xynC83 in P.
pastoris. The gene fragments coding for mature XynC81 and
XynC83 without the signal peptide sequences were amplified with
expression primers as shown in Table 1. The PCR products were
digested with EcoRI and NotI and then cloned into the pPIC9 vector
in-frame fusion of the α-factor signal peptide to construct the
recombinant plasmids. The recombinant plasmids, pPIC9-xynC81 and
pPIC9-xynC83, were linearized using BglII and transformed into P.
pastoris GS115 competent cells, respectively, by using a Gene Pulser
Xcell Electroporation System (Bio-Rad, Hercules, CA, USA). The
positive transformants were screened on the basis of their enzymatic
activities in shake tubes. The ones with highest activities were selected
for fermentation in 1 L shake flasks following the method described by
Qiu et al.16
Purification of Recombinant Xylanases. The 2-day-old P.
pastoris cultures induced by 0.5% methanol were collected by
centrifugation at 12000g for 10 min at 4 °C. The cell-free culture
supernatants were then concentrated with a Vivaflow 50 ultrafiltration
membrane of 5 kDa molecular weight cutoff (Vivascience, Hannova,
Germany) and loaded onto a HiTrap SP Sepharose XL FPLC column
(GE Healthcare, Uppsala, Sweden) for XynC81 and a Superdex 75 10/
300 GL column (GE Healthcare) for XynC83. The HiTrap SP
Sepharose XL FPLC column was equilibrated with buffer A (20 mM
McIlvaine buffer, pH 6.0), and proteins were eluted using a linear
gradient of NaCl (0−1.0 M) in the same buffer at a flow rate of 3 mL/
min. The Superdex 75 10/300 GL column was equilibrated with
McIlvaine buffer (50 mM, pH 6.0), and proteins were eluted using the
same buffer at a flow rate of 0.5 mL/min. The fractions exhibiting
xylanase activities were collected and subjected to sodium dodecyl
sulfate−polyacrylamide gel electrophoresis (SDS-PAGE) analysis.17
The protein concentrations were determined according to the
Bradford method18 using a protein assay kit (Bio-Rad) with bovine
serum albumin as the standard. The purified recombinant enzymes
were deglycosylated with endo-β-N-acetylglucosaminidase H (Endo
H) according to the manufacturer’s instructions (New England
Biolabs, Ipswich, MA, USA). Both the deglycosylated and untreated
enzymes were analyzed by SDS-PAGE.
coli Trans1-T1 and the plasmid pEASY-T3 for gene cloning and
sequencing were purchased from TransGen (Beijing, China). P.
pastoris GS115 and the plasmid pPIC9 from Invitrogen (Carlsbad,
CA) were used for heterologous expression. E. coli Trans1-T1 and P.
pastoris GS115 were cultivated in Luria−Bertani (LB) medium at 37
°C and yeast peptone dextrose (YPD) medium at 30 °C, respectively.
Birchwood xylan, beechwood xylan, barley β-glucan, carboxymethyl
cellulose sodium (CMC-Na), and Avicel were purchased from Sigma-
Aldrich (St. Louis, MO, USA). Soluble and insoluble wheat
arabinoxylans were obtained from Megazyme (Wicklow, Ireland).
The DNA purification kit and LA Taq DNA polymerase were
purchased from TaKaRa (Dalian, China). The restriction endonu-
cleases and T4 DNA ligase were from Thermo Fisher Scientific
(Waltham, MA, USA) and Promega (Madison, WI, USA),
respectively. All chemicals were of analytical grade and commercially
available.
Cloning of the Xylanase Genes from Strain Xz-8. Genomic
DNA of strain Xz-8 was extracted and purified with a Fungal DNA
Isolation Kit (Omega Biotek, Norcross, GA, USA). The core regions
of the encoding genes were amplified by degenerate primers X11-F
and X11-R specific for GH 11 xylanases13 with the genomic DNA of
strain Xz-8 as the template. The PCR products were ligated into the
pEASY-T3 vector for sequencing and analyzed using BLASTx (http://
www.ncbi.nlm.nih.gov/BLAST/). The 5′ and 3′ flanking regions of the
core regions were obtained by using the fusion primer and nested
integrated PCR (FPNI-PCR)14 and assembled with the known core
regions by using the ContigExpress software (Invitrogen).
To induce xylanase production, strain Xz-8 was grown in the
medium containing 5 g/L NaCl, 5 g/L (NH4)2SO4, 1 g/L KH2PO4,
0.5 g/L MgSO4·7H2O, 0.2 g/L CaCl2, 0.01 g/L FeSO4·7H2O, and 50
g/L wheat bran for 3 days at 45 °C. The mycelia were collected, and
the total RNA was extracted and purified using the SV Total RNA
Isolation System (Promega) according to the manufacturer’s
instructions. The full-length cDNAs of xylanase-encoding genes were
amplified from total RNA by RT-PCR with the ReverTra Ace-α-TM
kit (TOYOBO, Osaka, Japan), fast-pfu DNA polymerase (Transgen,
Beijing, China) and two specific primer sets (Table 1). The specific
PCR products were purified and ligated into the pEASY-T3 vector for
sequencing.
Sequence Analysis. DNA and protein sequences were aligned
using the BLASTn and BLASTp programs (http://www.ncbi.nlm.nih.
gov/BLAST/), respectively. Genes, introns, exons, and transcription
initiation sites were predicted using the online software FGENESH
(http://linux1.softberry.com/berry.phtml). The signal peptide was
predicted using SignalP 4.0 Server (http://www.cbs.dtu.dk/services/
SignalP/). The potential N-glycosylation sites were predicted online
(http://www.cbs.dtu.dk/services/NetNGlyc/). Multiple sequence
alignments were performed with ClustalW.15 Homology modeling
and calculations of protein ionization and electrostatic potential were
performed using Accelrys Discovery Studio software (DS 2.5, http://
www.accelrys.com).
Xylanase Activity Assay. The xylanase activity was determined
according to a 3,5-dinitrosalicylic acid (DNS) method.19 The standard
reaction system consisted of 100 μL of properly diluted enzyme and
900 μL of 100 mM McIlvaine buffer (pH 5.5) containing 1% (w/v)
beechwood xylan at 50 °C for 10 min. The reaction was terminated by
the addition of 1.5 mL of DNS reagent. The mixture was boiled for
exactly 5 min and cooled to room temperature, and its absorbance at
540 nm was measured. The reaction system with the same enzyme
sample added after DNS reagent was treated as a control. All assays
were run in triplicate. One unit of xylanase activity was defined as the
amount of enzyme that released 1 μmol of reducing sugar per minute
from the substrate equivalent to xylose under the assay conditions (pH
5.5, 50 °C, 10 min).
Biochemical Characterization. Beechwood xylan was used as the
substrate for enzyme characterization. The optimal pH of enzyme
6881
dx.doi.org/10.1021/jf4001296 | J. Agric. Food Chem. 2013, 61, 6880−6889

Journal of Agricultural and Food Chemistry
Article
activity was determined at 50 °C for 10 min in buffers over the pH
range from 3.0 to 12.0. The buffers used were 100 mM McIlvaine
buffer (pH 3.0−8.0), 100 mM Tris-HCl (pH 8.0−9.0), and 100 mM
glycine−NaOH (pH 9.0−12.0). For the pH stability assay, enzymes
were incubated in buffers of pH 3.0−11.0 at 37 °C for 1 h without the
substrate, and then the residual enzyme activity was measured at pH
5.5 and 50 °C for 10 min.
The optimal temperature for enzyme activity was examined at pH
5.5 for 10 min over the temperature range from 30 to 90 °C. For the
thermal stability, the enzymes were incubated without substrate at 55,
65, or 75 °C for 2, 5, 10, 15, 20, 30, and 60 min, and the residual
enzyme activity was measured under the standard conditions.
To determine the effect of different metal ions and chemical
reagents on the enzyme activities of purified recombinant XynC81 and
XynC83, 1 and 5 mM concentrations of various metal ions (Na+, K+,
Li+, Ag+, Ca2+, Co2+, Cr3+, Ni2+, Cu2+, Mg2+, Mn2+, Zn2+, Pb2+, Hg2+,
and Fe3+) and chemical reagents (SDS, EDTA, and β-mercaptoetha-
nol) were added to the reaction system individually. The system
without any additive was used as a control, and each assay was
measured under the standard assay conditions.
Kinetic Analysis. The Km and Vmax values for the purified
recombinant enzymes were determined from Lineweaver−Burk plots
using the nonlinear regression computer program GraFit (version 7,
Erithacus Software, Horley, UK). The enzyme activities were assayed
at 50 °C in McIlvaine buffer (pH 5.5) for 5 min containing 0.1−1%
(w/v) beechwood xylan as the substrate. Each experiment was
repeated three times, and each experiment included three replicates.
Substrate Specificity and Analysis of Hydrolysis Products.
The substrate specificities of the purified recombinant XynC81 and
XynC83 were determined in the standard assay system containing one
of the following substrates (1%; w/v): birchwood xylan, beechwood
xylan, soluble and insoluble wheat arabinoxylan, barley β-glucan,
CMC-Na, and Avicel.
To analyze their hydrolysis products, reaction systems as described
by Li et al.20 were used with some modifications. Extra enzyme (10 U)
and 100 μg of substrate (birchwood xylan, beechwood xylan, or
soluble wheat arabinoxylan) in 140 μL of McIlvaine buffer (pH 5.5)
were incubated at 50 °C for 12 h. After removal of the enzyme from
the reaction using the Amicon Ultra-0.5 Centrifugal Filter Unit with
Ultracel-3 membrane (Millipore, Billerica, MA, USA), the hydrolysis
products of each reaction were analyzed by high-performance anion-
exchange chromatography (HPAEC) with a model 2500 system from
Dionex (Sunnyvale, CA, USA). Xylose, xylobiose, xylotriose, and
xylotetraose were used as standards.
(μ
− μ) × 100
control
Δμ =
μ
control
μ is the viscosity, t is the total flow time through the viscometer, Δμ is
the viscosity reduction, and ρ is the density.
Nucleotide Sequence Accession Numbers. The nucleotide
sequences of the ITS-5.8S rDNA, β-tubulin gene, RNA polymerase II
second largest subunit gene, translation elongation factor 1α gene, and
the two GH 11 xylanase genes xynC81 and xynC83 of Achaetomium sp.
Xz-8 were deposited in the GenBank database under accession
numbers KC254730, KF042858, KF042859, KF042860, KC254725,
and KC254726, respectively.
RESULTS
■
Microorganism Isolation. The harsh desert climate is
generally dry and hot, and the temperature of the sand surface
at the sampling site reaches up to 50 °C during the daytime.
Such an environment is ideal for the isolation of thermophiles.
Among all of the fungal isolates, strain Xz-8 showed the largest
clear zone on beechwood xylan agar plates with Congo red
dying, that is, had the most significant xylanase activity. Strain
Xz-8 showed optimal growth at 45 °C and grew better at
temperatures above 45 °C than at 25 °C, suggesting that strain
Xz-8 is a typical thermophilic fungus.
The strain of Xz-8 was classified as a strain of Achaetomium
by the molecular phylogeny tree using the ITS-5.8S rDNA
sequence, the β-tubulin gene, the RNA polymerase II second
largest subunit gene, and the translation elongation factor 1α
gene of the strain Xz-8 and those of A. globosum (type species
of the genus of Achaetomium), Achaetomium crystallim,
Achaetomium luteum, Achaetomium strumarium and Chaetomium
luteum of the Centraalbureau Voor Schimmelcultures Fungal
Biodiversity Center (CBS) (data not shown). Achaetomium sp.
Xz-8 was deposited in the China General Microbiological
Culture Collection Center under registration number CGMCC
6545.
Gene Cloning and Sequence Analysis. Two different
fragments were amplified from the genomic DNA of
Achaetomium sp. Xz-8 by degenerate primers of X11-F and
X11-R specific for GH 11 xylanase genes. The 5′ and 3′
flanking regions of each core region were obtained by using
FPNI-PCR and were assembled with the core regions to obtain
two full-length genomic sequences, 1080 bp for xynC81 and
722 bp for xynC83. Three (85, 71, and 75 bp, respectively) and
one (62 bp) intron interrupted the coding sequences of xynC81
and xynC83, respectively. A putative signal peptide was
identified at the N-terminus of each xylanase, residues 1−19
for XynC81 and residues 1−16 for XynC83. The calculated
molecular masses were 27.5 kDa for XynC81 and 21.9 kDa for
XynC83. Both xylanases had putative N-glycosylation sites, one
(Asn 91) for XynC81 and two (Asn 20 and Asn 90) for
XynC83.
Sequence analysis indicated that XynC81 consists of a
catalytic domain of GH 11 at the N-terminus and a cellulose
binding module (CBM) of family 1 at the C-terminus, whereas
XynC83 contains only a catalytic domain of GH 11. Although
both XynC81 and XynC83 were from the same microbial
source and belong to the same family, they showed significant
divergence with an identity of <62% to each other. The
deduced sequence of XynC81 showed the highest identity of
83% with the GH 11 endo-β-1,4-xylanase (CgXB;
BAA08650.1) from Chaetomium gracile and 69% with the GH
11 xylanase Xyn11A from Chaetomium thermophilum with
crystal structure (PDB 1XNK).23 Deduced XynC83 exhibited
Effects of Xylanases on the Filtration Rate and Viscosity of
Mash. Preparation of the mash and assays to determine the filtration
rate and viscosity followed the methods described by Bai et al.21
Reactions contained 50 mL of mash and 1.0 mL of each xylanase (40
U), the commercial β-glucanase Glu-66 (40 U) from Xiasheng
(Ningxia, China), the xylanase combination (20 U of each xylanase),
the enzyme combinations of each xylanase (20 U of XynC81 or
XynC83), and Glu-66 (20 U) or the commercial enzyme complex
Ultraflo (40 U) from Novozymes (Copenhagen, Denmark). The
reaction containing 1.0 mL of McIlvaine buffer (100 mM, pH 5.5)
instead of enzyme solution was used as the control. The reduction of
the filtration time and the viscosity were calculated using the following
equations:22
(ψ
− ψ) × 100
control
Δψ =
ψ
control
ψ is the total flow time of 5 mL mash, and Δψ is the filtration time
reduction.
(μ
× t × ρ)
water
μ =
(twater × ρ
)
water
6882
dx.doi.org/10.1021/jf4001296 | J. Agric. Food Chem. 2013, 61, 6880−6889

Journal of Agricultural and Food Chemistry
Article
Figure 1. Sequence comparison of XynC81 and XynC83 to other fungal xylanasesL multiple amino acid sequence alignment of xylanases XynC81
and XynC83 from Achaetomium sp. Xz-8 with endo-β-1,4-xylanases from Chaetomium gracile (CgXA and CgXB; BAA08649.1 and BAA08650.1,
respectively) and Chaetomium globosum CBS 148.51 (XylCg; EAQ93839.1) and endoxylanase 11A from Chaetomium thermophilum (Xyn11A;
CAD48749.1). Identical and conserved residues are shaded in black and gray, respectively. The two putative catalytic residues are indicated with
triangles. The consensus sequence (PSIXG) of the GH 11 is enclosed in a solid box, and the putative cellulose binding module (CBM) of family 1
and the linker region of XynC81 are indicated by dashed boxes and a horizontal arrow, respectively.
the highest identity of 90% with GH 11 endo-β-1,4-xylanase A
(CgXA; BAA08649.1) from C. gracile and 65% with the endo-
1,4-β-xylanase 2 of GH 11 from Trichoderma reesei with crystal
structure (PDB 2D97).24 Both deduced xylanases have two
catalytic residues of glutamate and consensus sequence PSIXG
(X corresponds to a nonconserved residue) conserved in all
GH 11 xylanases (Figure 1). The consensus sequence of the
“thumb” loop is of importance in the catalytic efficiency of GH
11 xylanases.25 On the basis of the template crystal structures
(1XNK for XynC81 and 2D97 for XynC83), molecular models
of XynC81 and XynC83 were built with Accelrys Discovery
Studio software (DS 2.5), respectively (Figure 2). The catalytic
domains of XynC81 and XynC83 like other GH 11 xylanases
contain two twisted antiparallel β-sheets and a single α-helix
that resembles the shape of a partially closed right hand.
Expression and Purification of Recombinant XynC81
and XynC83. The gene fragments coding for mature XynC81
and XynC83 without the signal peptides were cloned into the
pPIC9 vector and then transformed into P. pastoris GS115
competent cells, respectively. After induction with methanol for
48 h, the highest xylanase activities of 154.5 and 32.2 U/mL
were detected in the culture supernatants of recombinant P.
pastoris harboring xynC81 and xynC83, respectively. The results
indicated that both genes encoded functional xylanases and
were successfully expressed in P. pastoris.
After a three-step purification process, both recombinant
XynC81 and XynC83 were purified to electrophoretic
homogeneity (Table 2; Figure 3). The specific activity toward
beechwood xylan of the pure XynC81 and XynC83 reached
2754.5 and 454.5 U/mg, respectively. Purified XynC81 showed
two bands between 26 and 34 kDa on SDS-PAGE, and purified
XynC83 showed a single band of approximately 22 kDa. After
Endo H treatment specific for N-glycosylation removal, the
deglycosylated XynC81 and XynC83 migrated as a single band
of about 28 and 22 kDa, respectively, which were essentially
identical to their calculated molecular weights. This indicated
6883
dx.doi.org/10.1021/jf4001296 | J. Agric. Food Chem. 2013, 61, 6880−6889

Journal of Agricultural and Food Chemistry
Article
Figure 2. Molecular modeling of XynC81 (a) and XynC83 (b). The α-helix is shown in red, and the β-sheets are in blue. The figures were generated
by using Accelrys Discovery Studio software DS 2.5. The putative catalytic site residues, Glu116 and Glu207 of XynC81 and Glu115 and Glu206 of
XynC83, correspond to the crystal structures of 1XNK and 2D97, respectively.
Table 2. Summary of the Purification of XynC81 and XynC83
enzyme activity
(U/mL)
specific activity
total activity (U)
(U/mg)
purification fold
recovery (%)
purification step
culture supernatant
XynC81 XynC83 XynC81 XynC83 XynC81 XynC83 XynC81 XynC83 XynC81 XynC83
154.5
1254.8
410.4
32.2
268.4
114.8
77250
62740
10260
16100
13420
2870
33.6
94.1
6.6
16.5
1.0
2.8
1.0
2.5
100.0
81.2
13.3
100.0
83.4
17.8
ultrafilteration
a
cation exchange/gel filtration chromatography
2754.5
454.5
82.0
68.9
a
The final purification step was cation-exchange chromatography for XynC81 and gel filtration chromatography for XynC83.
°C for 1 h (Figure 4b). The optimal temperatures for XynC81
and XynC83 activities were 60−65 °C at pH 5.5 (Figure 4c).
The enzymes were stable at 55 °C for 1 h, retaining >80% of
their initial activities (Figure 4d). At 65 and 75 °C, both
enzymes lost activities rapidly.
The effect of different metal ions or chemical reagents on the
activities of purified XynC81 and XynC83 were determined
(Table 3). XynC81 was resistant to all tested metal ions and
chemical reagents at 1 and 5 mM. XynC83 was resistant to
most tested chemicals at low concentration, but was partially
inhibited by SDS, Pb2+, Cr3+, Ca2+, Ni2+, and Fe3+ at 5 mM
concentration. The activities of both XynC81 and XynC83
were enhanced by β-mercaptoethanol.
Kinetic Analysis. According to the Lineweaver−Burk plots
(Figure 5), the Km and Vmax values of XynC81 were 0.31
0.004 mg/mL and 4049
16.9 μmol/min/mg, respectively,
and the Km and Vmax values of XynC83 were 0.47 0.007 mg/
mL and 848 5.8 μmol/min/mg, respectively. The kcat values
of XynC81 and XynC83 were 1866 and 311/s, respectively.
The catalytic efficiencies (kcat/Km) of XynC81 and XynC83
were 6082 and 661 mL/s/mg, respectively.
Substrate Specificity and Analysis of Hydrolysis
Products. Purified recombinant XynC81 and XynC83 were
most active on soluble wheat arabinoxylan (100%), moderate
on beechwood xylan (67 and 69%, respectively) and birchwood
xylan (45 and 52%, respectively), and weak on barley β-glucan
(18 and 14%, respectively). Only XynC81 had detectable
activity against insoluble wheat arabinoxylan (22%). No activity
was detected in the presence of CMC-Na and Avicel.
Figure 3. SDS-PAGE analysis of purified recombinant XynC81 and
XynC83. Lanes: M, molecular mass standards; 1 and 3, purified
recombinant XynC81 and XynC83; 2 and 4, deglycosylated XynC81
and XynC83 with Endo H treatment.
that no glycosylation occurred in XynC83 during heterologous
expression in P. pastoris.
Enzymatic Properties of Purified XynC81 and XynC83.
Purified recombinant XynC81 and XynC83 had a pH optimum
at pH 5.5 (at 50 °C), and >60% of their maximum activities was
retained between pH 5.0 and 7.0 (Figure 4a). Both enzymes
were stable under acidic to alkaline conditions, retaining >75%
of the initial activity after preincubation at pH 5.0−11.0 and 37
The hydrolysis products of soluble wheat arabinoxylan,
beechwood xylan, and birchwood xylan by XynC81 and
XynC83 were analyzed by HPAEC (Table 4). Both enzymes
were efficient in the hydrolysis of beechwood xylan and
6884
dx.doi.org/10.1021/jf4001296 | J. Agric. Food Chem. 2013, 61, 6880−6889

Journal of Agricultural and Food Chemistry
Article
Figure 4. Characterization of purified recombinant XynC81 and XynC83. (a) Effect of pH on enzyme activities. The activity assay was performed at
50 °C in buffers of pH 3.0−11.0 for 10 min. (b) pH stabilities of xylanases at 37 °C for 1 h at pH 3.0−11.0. The residual activity was measured in
100 mM McIlvaine buffer (pH 5.0, 50 °C). (c) Effect of temperature on enzyme activities measured in 100 mM McIlvaine buffer (pH 5.0) for 10
min. (d) Thermostability assay in 100 mM McIlvaine buffer (pH 5.0) at 55, 65, and 75 °C. Each value in the panel represents the mean SD (n =
3).
Table 3. Effect of Metal Ions and Chemical Reagents on the Activity of Purified Recombinant XynC81 and XynC83
XynC81
XynC83
a
relative activity (%)
1 mM
100.0
5 mM
100.0
1 mM
100.0
5 mM
100.0
control
Co2+
Ni2+
104.8 1.3
105.2 1.6
101.9 1.6
109.2 1.8
102.4 1.1
105.1 0.6
94.5 0.2
100.4 0.3
93.1 2.0
99.8 0.8
95.8 0.3
99.2 0.5
99.4 2.0
131.6 0.6
100.0 0.8
89.0 1.3
102.1 2.1
99.2 2.4
99.2 0.5
98.5 0.4
97.2 0.7
96.9 2.8
88.8 1.8
93.2 1.3
86.6 1.5
92.2 1.6
91.6 0.7
91.6 0.3
89.9 1.0
167.0 2.1
91.2 0.4
84.1 1.6
97.7 1.3
98.4 1.7
114.0 0.4
121.6 1.6
118.9 0.2
121.5 0.4
96.9 1.0
97.8 0.3
100.4 1.0
102.3 0.6
98.2 0.5
92.8 1.1
101.9 0.2
133.8 0.3
88.3 1.0
97.8 1.1
105.3 0.2
90.1 0.8
99.2 0.9
107.5 0.6
111.1 0.2
117.5 2.5
92.0 1.0
100.0 2.1
50.2 0.4
96.6 0.8
89.6 0.7
57.5 1.8
71.5 2.1
124.8 1.7
68.3 0.5
72.6 0.6
Mn2+
K+
Li+
Na+
Cu2+
Zn2+
Pb2+
Mg2+
Fe3+
Ca2+
Cr3+
β-mercaptoethanol
EDTA
SDS
a
Values represent the mean SD (n = 3) relative to the untreated control samples.
birchwood xylan, approximately 90% of which have been
degraded into xylooligosaccharides. The hydrolysis products of
soluble wheat arabinoxylan were complex, and the composition
of xylooligosaccharides was <40%. Xylobiose and xylotriose
were the major hydrolysis products of all tested substrates.
Effects on Filtration Rate and Viscosity of Mash. A
total of seven enzyme treatments were used to test their
performance in mash processing (Table 5). All of the enzymes
tested had positive effects on the filtration rate improvement
and viscosity reduction. The highest filtration rate (34.76%)
was achieved when the mash was treated with the combination
of XynC83 and Glu-66, which was 14.05% higher than the
commercial Ultraflo (20.71%). The enzyme combination of
XynC81 and XynC83 showed a synergistic effect on viscosity
reduction (7.08 vs 6.31% for XynC81 and 5.34% for XynC83),
which was comparable to that for Ultraflo (8.47%).
6885
dx.doi.org/10.1021/jf4001296 | J. Agric. Food Chem. 2013, 61, 6880−6889

Journal of Agricultural and Food Chemistry
Article
Figure 5. Lineweaver−Burk plots for the hydrolysis of beech xylan by purified XynC81 (a) and XynC83 (b). The figures were generated by the
nonlinear regression computer program GraFit 7.
Table 4. Hydrolysis Products of XynC81 and XynC83
enzyme
XynC81
substrate
xylose (%)
xylobiose (%)
xylotriose (%)
xylotetraose (%)
undetermined (%)
soluble wheat arabinoxylan
birchwood xylan
5.20
2.92
4.57
25.12
60.99
61.94
5.32
21.97
21.76
0
64.36
10.97
10.42
3.15
1.31
beechwood xylan
XynC83
soluble wheat arabinoxylan
birchwood xylan
2.93
0
27.69
58.77
60.75
5.51
26.69
23.83
0
63.87
11.14
11.00
3.40
2.74
beechwood xylan
1.68
had similar pH and temperature properties, they showed several
different characteristics. XynC81showed higher catalytic
efficiency than XynC83 and was more resistant to most metal
ions and chemical reagents tested. XynC83 could hydrolyze
birchwood xylan into a mixture of xylooligosaccharides without
xylose. All of these property divergences show the diversity of
xylanases from Achaetomium sp. Xz-8.
Of all the GH 11 xylanases characterized so far, about 25% of
them carry at least one CBM.2 Unlike the serine/threonine/
asparagine-rich linker sequence found in other fungal xylanases,
the XynC81 linker sequence is extremely glycine-rich. To our
knowledge, CBMs take part in the action of cellulolytic
enzymes toward insoluble substrates.26,27 In the present study,
although most enzymatic properties of XynC81 and XynC83
were similar, XynC81 with CBM 1 had activity against insoluble
wheat arabinoxylan (22%), whereas XynC83 had not. This
result further implied the importance of CBM in enzyme
activity toward insoluble substrate.
Most known fungal xylanases of family 11 have acidophilic
pH optima, and the temperature optima of GH 11 xylanases
from thermophilic fungi are within 62−80 °C.2 The pH and
temperature optima of XynC81 and XynC83 fall within these
ranges, exhibiting the highest activity at pH 5.5 and 60−65 °C,
respectively. Compared with other GH 11 xylanases with CBM
1, XynC81 has higher optimal temperature and better
thermostability.28−31 The catalytic constant (kcat/Km) is often
recognized as a critical parameter to allow enzyme assessment
and comparison. In the present study, XynC81 exhibits a
catalytic efficiency of 6082 mL/s/mg, which is the second most
efficient xylanase. Compared with other fungal xylanases,
Table 5. Effects of XynC81 and XynC83 Alone or in
Combination with Glucanase Glu-66 on the Filtration Rate
and Viscosity of Mash
filtration rate improvement viscosity reduction
enzyme
XynC81
(%)
(%)
14.29
18.10
17.50
15.51
22.46
34.76
20.71
6.31
5.34
7.08
2.73
6.55
5.68
8.47
XynC83
XynC81:XynC83 (1:1)
Glu-66
XynC81:Glu-66 (1:1)
XynC83:Glu-66 (1:1)
Ultraflo
DISCUSSION
■
To our knowledge, fungi are generally considered as more
potent producers of xylanases than bacteria and yeasts. Fungal
genera that are known to produce xylanases include Aspergillus,
Disporotrichum, Penicillium, Neurospora, Fusarium, Chaetomium,
Trichoderma, etc.6 In this study, we isolated a typical
thermophilic fungal strain Xz-8 of Achaetomium that showed
optimal growth at 45 °C. Two GH 11 xylanase genes (xynC81
and xynC83) were identified in Achaetomium sp. Xz-8 and were
successfully expressed in P. pastoris. This is the first report on
gene cloning and expression of xylanases from Achaetomium.
Whereas both XynC81 and XynC83 were from the same
microbial source and belong to GH 11, they showed only 62%
identity to each other. Besides a family 11 catalytic domain,
XynC81 contains a C-terminal family 1 CBM. Although they
6886
dx.doi.org/10.1021/jf4001296 | J. Agric. Food Chem. 2013, 61, 6880−6889

Journal of Agricultural and Food Chemistry
Article
Table 6. Comparison of the Enzymatic Properties of XynC81 and XynC83 with Those of Other Fungal Counterparts
optimum
name
organism
Aspergillus niger
pH
temp
Vmax (μmol/min/mg)
Km (mg/mL)
kcat (/s)
kcat/Km (mL/s/mg)
AnxA32
Xyn11A28
TfxA33
5.0
5.0
6.0
6.0
5.5
5.8
5.5
5.0
5.5
5.5
5.5
5.5
50
40
60
40
55
49
55
50
60
40
60
65
4.8
123
238
26
41
Podospora anserina
405
5.8
Thermomonospora fusca
Plectosphaerella cucumerina
Penicillium griseofulvum
Neocallimastix patriciarum
Penicillium funiculosum
Trichoderma reesei Rut C-30
Pholiota adiposa
2.45
2.1
139
57
XYNZG34
PgXynA35
XynS20E36
PfXynC37
Xyn238
490
842
158
75
3.3
292
88
153
1.9
185
97
2835
6.7
997
149
930
1290
7640
6082
661
0.114
3.3
106
PaXyl39
6910
4530
4049
848
4257
1528
1866
311
XylCg40
XynC81
XynC83
Chaetomium globosum
Achaetomium sp. Xz-8
Achaetomium sp. Xz-8
0.2
0.31
0.47
XynC81 and XynC83 not only have higher catalytic efficiency
but also show higher temperature optima (Table 6). The higher
catalytic efficiency and optimum temperature of the recombi-
nant xylanases clearly indicate their industrial potential in the
hydrolysis of xylan.
AUTHOR INFORMATION
Corresponding Author
*(B.Y.) Key Laboratory for Feed Biotechnology of the Ministry
of Agriculture, Feed Research Institute, Chinese Academy of
Agricultural Sciences, No. 12 Zhongguancun South Street,
Beijing 100081, P. R. China. E-mail: binyao@caas.cn, yaobin@
caas.cn. Phone: +86 10 82106053. Fax: +86 10 82106054.
■
The major hydrolysis products of three xylan substrates
under study were xylobiose and xylotriose by XynC81 and
XynC83. Interestingly, XynC83 hydrolyzed birchwood xylan
into a mixture of xylooligosaccharides without xylose. This
characteristic has been reported in the GH 11 xylanase from
Streptomyces matensis DW6741 and xylanase Xyn802 from
Streptomyces sp. CS802,42 which could make XynC83 an ideal
candidate for application in xylooligosaccharide production.43
In the brewing industry, mashing is a very traditional but
complex and remarkably ill-defined process, involving a mix of
soluble and insoluble substrates and glycosidase inhibitors.
Arabinoxylan is the main nonstarch polysaccharide of barley
grain and can cause low extract yield, high wort viscosity,
decrease of filtration rate, and formation of some gelatinous
precipitates, consequently resulting in a serious technical
problem for the brewing industry.44,45 Considering the
conditions of mashing process, such as continuously rising
temperature and verified pH values, high-temperature-active
xylanases are generally preferred to facilitate the degradation of
arabinoxylan in barley malts.16,46 In this study, XynC81,
XynC83, and their combination were supplemented into
mash and showed performance in filtration rate improvement
and viscosity reduction comparable with that the commercial
enzyme complex Ultraflo. However, due to the heterogeneity of
the composition and structure of barley, addition of xylanase is
insufficient to improve the filtration rate or reduce the viscosity
during the mashing process. The effectiveness of the
combination xylanase and β-glucanase on barley viscosity
decrease could be greater than that of xylanase or β-glucanase
alone.47 In the present study, the noticeable synergistic action
of XynC81/XynC83 and the commercial β-glucanase Glu-66
was observed in the filtration rate improvement.
Author Contributions
∥L.Z. and K.M. contributed equally to this work.
Funding
This work was supported by the National High Technology
Research and Development Program of China
(2012AA022208), the National Natural Science Foundation
of China (31201829), and the China Modern Agriculture
Research System (CARS-42).
Notes
The authors declare no competing financial interest.
ACKNOWLEDGMENTS
■
We thank Dr. Xuewei Wang, Institute of Microbiology, Chinese
Academy of Sciences, Beijing, China, for her great efforts in the
identification of Achaetomium sp. Xz-8.
ABBREVIATIONS USED
■
BLAST, basic local alignment search tool; CBM, carbohydrate
binding module; MC-Na, carboxymethyl cellulose sodium;
DNS, 3,5-dinitrosalicylic acid; Endo H, endo-β-N-acetylgluco-
saminidase H; FPNI-PCR, fusion primer and nested integrated
PCR; GH, glycoside hydrolase; HPAEC, high-performance
anion-exchange chromatography; LB, Luria−Bertani; SDS-
PAGE, sodium dodecyl sulfate−polyacrylamide gel electro-
phoresis
REFERENCES
■
(1) Henrissat, B.; Bairoch, A. New families in the classification of
glycosyl hydrolases based on amino acid sequence similarities.
Biochem. J. 1993, 29, 781−788.
(2) Paes, G.; Berrin, J. G.; Beaugrand, J. GH11 xylanases: structure/
function/properties relationships and applications. Biotechnol. Adv.
2012, 30, 564−592.
(3) Collins, T.; Gerday, C.; Feller, G. Xylanases, xylanase families and
extremophilic xylanases. FEMS Microbiol. Rev. 2005, 29, 3−23.
(4) Polizeli, M. L. T. M.; Rizzatti, A. C. S.; Monti, R.; Terenzi, H. F.;
Jorge, J. A.; Amorim, D. S. Xylanases from fungi: properties and
industrial applications. Appl. Microbiol. Biotechnol. 2005, 67, 577−591.
Considering the excellent enzyme properties of XynC81 and
XynC83, such as high activity at pH 5.0−7.0 and at 40−70 °C,
good thermal and pH stability, less complex hydrolysis
products, strong resistance to most metal ions and chemical
reagents, and greater catalytic efficiency, XynC83 could be a
potential candidate for application in the xylooligosaccharide
production, and both XynC81 and XynC83 may represent ideal
candidates for application in the brewing industry.
6887
dx.doi.org/10.1021/jf4001296 | J. Agric. Food Chem. 2013, 61, 6880−6889

Journal of Agricultural and Food Chemistry
Article
(5) Beg, Q. K.; Kapoor, M.; Mahajan, L.; Hoondal, G. S. Microbial
xylanases and their industrial applications: a review. Appl. Microbiol.
Biotechnol. 2001, 56, 326−338.
(6) Ahmed, S.; Riaz, S.; Jamil, A. Molecular cloning of fungal
xylanases: an overview. Appl. Microbiol. Biotechnol. 2009, 84, 19−35.
(7) Maijala, P.; Kango, N.; Szijarto, N.; Viikari, L. Characterization of
hemicellulases from thermophilic fungi. Antonie Van Leeuwenhoek Int.
J. G. 2012, 101, 905−917.
(8) Rai, J. N.; Tewari, J. P.; Mukerji, K. G. Aghaetomium, a new geus
of ascomycetes. Can. J. Bot. 1964, 42, 693−697.
(9) Basu, M. Achaetomium thermophilum sp. nov., a new thermophilic
species of genus Achaetomium from India. Curr. Sci. 1982, 51, 524−
525.
(10) Wood, P. J.; Erfle, J. D.; Teather, R. M. Use of complex-
formation between Congo red and polysaccharides in detection and
assay of polysaccharide hydrolases. Methods Enzymol. 1988, 160, 59−
74.
(11) Korabecna, M.; Liska, V.; Fajfrlik, K. Primers ITS1, ITS2 and
ITS4 detect the intraspecies variability in the internal transcribed
spacers and 5.8S rRNA gene region in clinical isolates of fungi. Folia
Microbiol. 2003, 48, 233−238.
(12) White, T. J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and
direct sequencing of fungal ribosomal RNA genes for phylogenetics. In
PCR Protocols, a Guide to Methods and Applications; Gelfand, D. H.,
Sninsky, J. J., Eds.; Academic Press: San Diego, CA, 1990; pp 315−
322.
(13) Wang, G.; Wang, Y.; Yang, P.; Luo, H.; Huang, H.; Shi, P.;
Meng, K.; Yao, B. Molecular detection and diversity of xylanase genes
in alpine tundra soil. Appl. Microbiol. Biotechnol. 2010, 87, 1383−1393.
(14) Wang, Z.; Ye, S.; Li, J.; Zheng, B.; Bao, M.; Ning, G. Fusion
primer and nested integrated PCR (FPNI-PCR): a new high-efficiency
strategy for rapid chromosome walking or flanking sequence cloning.
BMC Biotechnol. 2011, 11, 109.
(15) Thompson, J. D.; Higgins, D. G.; Gibson, T. J. CLUSTAL W:
improving the sensitivity of progressive multiple sequence alignment
through sequence weighting, position-specific gap penalties and weight
matrix choice. Nucleic Acids Res. 1994, 22, 4673−4680.
(16) Qiu, Z.; Shi, P.; Luo, H.; Bai, Y.; Yuan, T.; Yang, P.; Liu, S.; Yao,
B. A xylanase with broad pH and temperature adaptability from
Streptomyces megasporus DSM 41476, and its potential application in
brewing industry. Enzyme Microb. Technol. 2010, 46, 506−512.
(17) Laemmli, U. K. Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 1970, 227, 680−
685.
(18) Bradford, M. M. A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the principle
of protein-dye binding. Anal. Biochem. 1976, 72, 248−254.
(19) Miller, G. L. Use of dinitrosalicylic acid reagent for
determination of reducing sugar. Anal. Chem. 1959, 31, 426−428.
(20) Li, N.; Meng, K.; Wang, Y.; Shi, P.; Luo, H.; Bai, Y.; Yang, P.;
Yao, B. Cloning, expression, and characterization of a new xylanase
with broad temperature adaptability from Streptomyces sp. S9. Appl.
Microbiol. Biotechnol. 2008, 80, 231−240.
hydrogen peroxide VIL (HYPER-VIL). Acta Crystallogr. D: Biol.
Crystallogr. 2006, 62, 280−289.
(25) Paes, G.; Tran, V.; Takahashi, M.; Boukari, I.; O’Donohue, M. J.
New insights into the role of the thumb-like loop in GH-11 xylanases.
Protein Eng. Des. Sel. 2007, 20, 15−23.
(26) Boraston, A. B.; Bolam, D. N.; Gilbert, H. J.; Davies, G. J.
Carbohydrate-binding modules: fine-tuning polysaccharide recogni-
tion. Biochem. J. 2004, 382, 769−781.
(27) Nimlos, M. R.; Matthews, J. F.; Crowley, M. F.; Walker, R. C.;
Chukkapalli, G.; Brady, J. W.; Adney, W. S.; Cleary, J. M.; Zhong, L.;
Himmel, M. E. Molecular modeling suggests induced fit of Family I
carbohydrate-binding modules with a broken-chain cellulose surface.
Protein Eng. Des. Sel. 2007, 20, 179−187.
(28) Couturier, M.; Haon, M.; Coutinho, P. M.; Henrissat, B.;
Lesage-Meessen, L.; Berrin, J. G. Podospora anserina hemicellulases
potentiate the Trichoderma reesei secretome for saccharification of
lignocellulosic biomass. Appl. Environ. Microbiol. 2011, 77, 237−246.
(29) Liu, J. R.; Duan, C. H.; Zhao, X.; Tzen, J. T. C.; Cheng, K. J.;
Pai, C. K. Cloning of a rumen fungal xylanase gene and purification of
the recombinant enzyme via artificial oil bodies. Appl. Microbiol.
Biotechnol. 2008, 79, 225−233.
(30) Lee, C.; Wong, D. W. S.; Robertson, G. H. Cloning and
characterization of the xyn11A gene from Lentinula edodes. Protein J.
2005, 24, 21−26.
(31) Decelle, B.; Tsang, A.; Storms, R. K. Cloning, functional
expression and characterization of three Phanerochaete chrysosporium
endo-1,4-β-xylanases. Curr. Genet. 2004, 46, 166−175.
(32) Liu, M. Q.; Weng, X. Y.; Sun, J. Y. Expression of recombinant
Aspergillus niger xylanase A in Pichia pastoris and its action on xylan.
Protein Expr. Purif. 2006, 48, 292−299.
(33) Sun, J. Y.; Liu, M. Q.; Weng, X. Y.; Qian, L. C.; Gu, S. H.
Expression of recombinant Thermomonospora fusca xylanase A in
Pichia pastoris and xylooligosaccharides released from xylans by it. Food
Chem. 2007, 104, 1055−1064.
(34) Zhang, G. M.; Huang, J.; Huang, G. R.; Ma, L. X.; Zhang, X. E.
Molecular cloning and heterologous expression of a new xylanase gene
from Plectosphaerella cucumerina. Appl. Microbiol. Biotechnol. 2007, 74,
339−346.
(35) Cervera, T. M.; Andre, L. G.; Lafond, M.; Georis, J.; Juge, N.;
Berrin, J. G. Molecular determinants of substrate and inhibitor
specificities of the Penicillium griseofulvum family 11 xylanases. Biochim.
Biophys. Acta 2009, 1794, 438−445.
(36) Pai, C. K.; Wu, Z. Y.; Chen, M. J.; Zeng, Y. F.; Chen, J. W.;
Duan, C. H.; Li, M. L.; Liu, J. R. Molecular cloning and
characterization of a bifunctional xylanolytic enzyme from Neo-
callimastix patriciarum. Appl. Microbiol. Biotechnol. 2010, 85, 1451−
1462.
(37) Berrin, J. G.; Ajandouz, E. H.; Georis, J.; Arnaut, F.; Juge, N.
Substrate and product hydrolysis specificity in family 11 glycoside
hydrolases: an analysis of Penicillium funiculosum and Penicillium
griseofulvum xylanases. Appl. Microbiol. Biotechnol. 2007, 74, 1001−
1010.
(38) Jun, H.; Bing, Y.; Keying, Z.; Xuemei, D.; Daiwen, C. Expression
of a Trichoderma reesei β-xylanase gene in Escherichia coli and activity of
the enzyme on fiber-bound substrates. Protein. Expr. Purif. 2009, 67,
1−6.
(21) Bai, Y.; Wang, J.; Zhang, Z.; Shi, P.; Luo, H.; Huang, H.; Luo,
C.; Yao, B. A novel family 9 β-1,3(4)-glucanase from thermoacido-
philic Alicyclobacillus sp. A4 with potential applications in the brewing
industry. Appl. Microbiol. Biotechnol. 2010, 87, 251−259.
(22) Celestino, K. R.; Cunha, R. B.; Felix, C. R. Characterization of a
β-glucanase produced by Rhizopus microsporus var. microsporus, and its
potential for application in the brewing industry. BMC Biochem. 2006,
7, 23.
(39) Dhiman, S. S.; Jagtap, S. S.; Jeya, M.; Haw, J. R.; Kang, Y. C.;
Lee, J. K. Immobilization of Pholiota adiposa xylanase onto SiO(2)
nanoparticles and its application for production of xylooligosacchar-
ides. Biotechnol. Lett. 2012, 34, 1307−1313.
(40) Singh, R. K.; Tiwari, M. K.; Kim, D.; Kang, Y. C.;
Ramachandran, P.; Lee, J. K. Molecular cloning and characterization
of a GH11 endoxylanase from Chaetomium globosum, and its use in
enzymatic pretreatment of biomass. Appl. Microbiol. Biotechnol. 2012,
DOI: 10.1007/s00253-012-4577-z.
(41) Yan, Q.; Hao, S.; Jiang, Z.; Zhai, Q.; Chen, W. Properties of a
xylanase from Streptomyces matensis being suitable for xylooligosac-
charides production. J. Mol. Catal. B: Enzym. 2009, 58, 72−77.
(23) Janis, J.; Hakanpaa, J.; Hakulinen, N.; Ibatullin, F. M.; Hoxha,
A.; Derrick, P. J.; Rouvinen, J.; Vainiotalo, P. Determination of
thioxylo-oligosaccharide binding to family 11 xylanases using electro-
spray ionization Fourier transform ion cyclotron resonance mass
spectrometry and X-ray crystallography. FEBS J. 2005, 272, 2317−
2333.
(24) Miyatake, H.; Hasegawa, T.; Yamano, A. New methods to
prepare iodinated derivatives by vaporizing iodine labelling (VIL) and
6888
dx.doi.org/10.1021/jf4001296 | J. Agric. Food Chem. 2013, 61, 6880−6889

Journal of Agricultural and Food Chemistry
Article
(42) Simkhada, J. R.; Yoo, H. Y.; Choi, Y. H.; Kim, S. W.; Yoo, J. C.
An extremely alkaline novel xylanase from a newly isolated
Streptomyces strain cultivated in corncob medium. Appl. Biochem.
Biotechnol. 2012, 168, 2017−2027.
(43) Cheng, F.; Sheng, J.; Dong, R.; Men, Y.; Gan, L.; Shen, L. Novel
xylanase from a holstein cattle rumen metagenomic library and its
application in xylooligosaccharide and ferulic acid production from
wheat straw. J. Agric. Food Chem. 2012, 60, 12516−12524.
(44) Bamforth, C. W. Current perspectives on the role of enzymes in
brewing. J. Cereal Sci. 2009, 50, 353−357.
(45) Vietor, R. J.; Voragen, A. G. J.; Angelino, S. A. G. F.; Pilnik, W.
̈
Non-starch polysaccharides in barley and malt: a mass balance of flour
fractionation. J. Cereal Sci. 1991, 14, 73−83.
(46) Li, Y.; Lu, J.; Gu, G.; Shi, Z.; Mao, Z. Mathematical modeling for
prediction of endo-xylanase activity and arabinoxylans concentration
during mashing of barley malts for brewing. Biotechnol. Lett. 2004, 26,
779−785.
(47) Mathlouthi, N.; Saulnier, L.; Quemener, B.; Larbier, M.
Xylanase, β-glucanase, and other side enzymatic activities have greater
effects on the viscosity of several feedstuffs than xylanase and β-
glucanase used alone or in combination. J. Agri. Food Chem. 2002, 50,
5121−5127.
6889
dx.doi.org/10.1021/jf4001296 | J. Agric. Food Chem. 2013, 61, 6880−6889